Informations

27.1 : Le Code Génétique - Biologie

27.1 : Le Code Génétique - Biologie


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

27.1 : Le code génétique

Le code génétique

Pour résumer ce que nous savons jusqu'à présent, le processus cellulaire de transcription génère de l'ARN messager (ARNm), une copie moléculaire mobile d'un ou plusieurs gènes avec un alphabet de A, C, G et d'uracile (U). La traduction de la matrice d'ARNm convertit l'information génétique basée sur les nucléotides en un produit protéique. Ce flux d'informations génétiques dans les cellules de l'ADN à l'ARNm à la protéine est décrit par le dogme central (figure 1), qui stipule que les gènes spécifient la séquence des ARNm, qui à leur tour spécifient la séquence des protéines. Le décodage d'une molécule à une autre est effectué par des protéines et des ARN spécifiques. Parce que les informations stockées dans l'ADN sont si essentielles à la fonction cellulaire, il est logique que la cellule fasse des copies d'ARNm de ces informations pour la synthèse des protéines, tout en gardant l'ADN lui-même intact et protégé.

Il s'avère que le dogme central n'est pas toujours vrai. Cependant, nous ne discuterons pas ici des exceptions.

Figure 1 Les instructions sur l'ADN sont transcrites sur l'ARN messager. Les ribosomes sont capables de lire les informations génétiques inscrites sur un brin d'ARN messager et d'utiliser ces informations pour enchaîner les acides aminés en une protéine.


Le dogme central : l'ADN code l'ARN L'ARN code la protéine

Figure 2. Les instructions sur l'ADN sont transcrites sur l'ARN messager. Les ribosomes sont capables de lire les informations génétiques inscrites sur un brin d'ARN messager et d'utiliser ces informations pour enchaîner les acides aminés en une protéine.

Le flux d'informations génétiques dans les cellules de l'ADN à l'ARNm à la protéine est décrit par le dogme central (figure 2), qui stipule que les gènes spécifient la séquence des ARNm, qui à leur tour spécifient la séquence des protéines. Le décodage d'une molécule à une autre est effectué par des protéines et des ARN spécifiques. Parce que les informations stockées dans l'ADN sont si essentielles à la fonction cellulaire, il est logique que la cellule fasse des copies d'ARNm de ces informations pour la synthèse des protéines, tout en gardant l'ADN lui-même intact et protégé. La copie d'ADN en ARN est relativement simple, un nucléotide étant ajouté au brin d'ARNm pour chaque nucléotide lu dans le brin d'ADN. La traduction en protéine est un peu plus complexe car trois nucléotides d'ARNm correspondent à un acide aminé dans la séquence polypeptidique. Cependant, la traduction en protéine est toujours systématique et colinéaire, de sorte que les nucléotides 1 à 3 correspondent à l'acide aminé 1, les nucléotides 4 à 6 correspondent à l'acide aminé 2, et ainsi de suite.


Biologie 171


Depuis la redécouverte des travaux de Mendel en 1900, la définition du gène est passée d'une unité abstraite d'hérédité à une entité moléculaire tangible capable de réplication, d'expression et de mutation ((Figure)). Les gènes sont composés d'ADN et sont disposés linéairement sur les chromosomes. Les gènes spécifient les séquences d'acides aminés, qui sont les éléments constitutifs des protéines. À leur tour, les protéines sont responsables de l'orchestration de presque toutes les fonctions de la cellule. Les gènes et les protéines qu'ils codent sont absolument essentiels à la vie telle que nous la connaissons.

Objectifs d'apprentissage

À la fin de cette section, vous serez en mesure d'effectuer les opérations suivantes :

  • Expliquer le « dogme central » de la synthèse ADN-protéine
  • Décrire le code génétique et comment la séquence nucléotidique prescrit l'acide aminé et la séquence protéique

Le processus cellulaire de transcription génère un ARN messager (ARNm), une copie moléculaire mobile d'un ou plusieurs gènes avec un alphabet de A, C, G et uracile (U). La traduction de la matrice d'ARNm sur les ribosomes convertit l'information génétique basée sur les nucléotides en un produit protéique. C'est le dogme central de la synthèse ADN-protéine. Les séquences protéiques se composent de 20 acides aminés courants, on peut donc dire que l'alphabet protéique se compose de 20 « lettres » ((Figure)). Différents acides aminés ont des chimies différentes (comme acide par rapport à basique, ou polaire et non polaire) et différentes contraintes structurelles. La variation de la séquence d'acides aminés est responsable de l'énorme variation de la structure et de la fonction des protéines.

Les structures des 20 acides aminés présents dans les protéines sont montrées. Chaque acide aminé est composé d'un groupe aminé (), un groupe carboxyle (COO – ) et une chaîne latérale (bleu). La chaîne latérale peut être non polaire, polaire ou chargée, ainsi que grande ou petite. C'est la variété des chaînes latérales d'acides aminés qui donne lieu à l'incroyable variation de la structure et de la fonction des protéines.

Le dogme central : l'ADN code l'ARN L'ARN code la protéine

Le flux d'informations génétiques dans les cellules de l'ADN à l'ARNm à la protéine est décrit par le dogme central ((Figure)), qui stipule que les gènes spécifient la séquence des ARNm, qui à leur tour spécifient la séquence des acides aminés constituant toutes les protéines. Le décodage d'une molécule à une autre est effectué par des protéines et des ARN spécifiques. Parce que les informations stockées dans l'ADN sont si essentielles à la fonction cellulaire, il est logique que la cellule fasse des copies d'ARNm de ces informations pour la synthèse des protéines, tout en gardant l'ADN lui-même intact et protégé. La copie d'ADN en ARN est relativement simple, un nucléotide étant ajouté au brin d'ARNm pour chaque nucléotide lu dans le brin d'ADN. La traduction en protéine est un peu plus complexe car trois nucléotides d'ARNm correspondent à un acide aminé dans la séquence polypeptidique. Cependant, la traduction en protéine est toujours systématique et colinéaire, de sorte que les nucléotides 1 à 3 correspondent à l'acide aminé 1, les nucléotides 4 à 6 correspondent à l'acide aminé 2, et ainsi de suite.

Le code génétique est dégénéré et universel

Chaque acide aminé est défini par une séquence de trois nucléotides appelée codon triplet. Étant donné le nombre différent de « lettres » dans les « alphabets » d'ARNm et de protéines, les scientifiques ont émis l'hypothèse que les acides aminés simples doivent être représentés par des combinaisons de nucléotides. Les doublets de nucléotides ne seraient pas suffisants pour spécifier chaque acide aminé car il n'y a que 16 combinaisons possibles de deux nucléotides (4 2 ). En revanche, il existe 64 triplets de nucléotides possibles (4 3 ), ce qui est bien plus que le nombre d'acides aminés. Les scientifiques ont émis l'hypothèse que les acides aminés étaient codés par des triplets de nucléotides et que le code génétique était « dégénéré ». En d'autres termes, un acide aminé donné pourrait être codé par plus d'un triplet de nucléotides. Cela a ensuite été confirmé expérimentalement : Francis Crick et Sydney Brenner ont utilisé la proflavine, un mutagène chimique, pour insérer un, deux ou trois nucléotides dans le gène d'un virus. Lorsqu'un ou deux nucléotides ont été insérés, les protéines normales n'ont pas été produites. Lorsque trois nucléotides ont été insérés, la protéine a été synthétisée et fonctionnelle. Cela a démontré que les acides aminés doivent être spécifiés par des groupes de trois nucléotides. Ces triplets de nucléotides sont appelés codons. L'insertion d'un ou deux nucléotides a complètement changé le cadre de lecture du triplet, modifiant ainsi le message pour chaque acide aminé suivant ((Figure)). Bien que l'insertion de trois nucléotides ait entraîné l'insertion d'un acide aminé supplémentaire pendant la traduction, l'intégrité du reste de la protéine a été maintenue.

Les scientifiques ont minutieusement résolu le code génétique en traduisant des ARNm synthétiques in vitro et en séquençant les protéines qu'ils ont spécifiées ((Figure)).

En plus des codons qui ordonnent l'ajout d'un acide aminé spécifique à une chaîne polypeptidique, trois des 64 codons terminent la synthèse des protéines et libèrent le polypeptide de la machinerie de traduction. Ces triplets sont appelés codons non-sens , ou codons d'arrêt. Un autre codon, AUG, a également une fonction spéciale. En plus de spécifier l'acide aminé méthionine, il sert également de codon de départ pour initier la traduction. Le cadre de lecture pour la traduction est défini par le codon de démarrage AUG près de l'extrémité 5 & 8242 de l'ARNm. Après le codon de départ, l'ARNm est lu par groupes de trois jusqu'à ce qu'un codon d'arrêt soit rencontré.

La disposition de la table de codage révèle la structure du code. Il y a seize « blocs » de codons, chacun étant spécifié par les premier et deuxième nucléotides des codons à l'intérieur du bloc, par exemple le bloc « « 8220AC* » 8221 qui correspond à l'acide aminé thréonine (Thr). Certains blocs sont divisés en une moitié pyrimidine, dans laquelle le codon se termine par U ou C, et une moitié purine, dans laquelle le codon se termine par A ou G. Certains acides aminés obtiennent un bloc entier de quatre codons, comme l'alanine (Ala) , la thréonine (Thr) et la proline (Pro). Certains obtiennent la moitié pyrimidine de leur bloc, comme l'histidine (His) et l'asparagine (Asn). D'autres obtiennent la moitié purine de leur bloc, comme le glutamate (Glu) et la lysine (Lys). Notez que certains acides aminés obtiennent un bloc et un demi-bloc pour un total de six codons.

La spécification d'un seul acide aminé par plusieurs codons similaires est appelée « dégénérescence ». On pense que la dégénérescence est un mécanisme cellulaire permettant de réduire l'impact négatif des mutations aléatoires. Les codons qui spécifient le même acide aminé ne diffèrent généralement que d'un nucléotide. De plus, les acides aminés avec des chaînes latérales chimiquement similaires sont codés par des codons similaires. Par exemple, l'aspartate (Asp) et le glutamate (Glu), qui occupent le bloc GA*, sont tous deux chargés négativement. Cette nuance du code génétique garantit qu'une mutation de substitution d'un seul nucléotide pourrait spécifier le même acide aminé mais n'avoir aucun effet ou spécifier un acide aminé similaire, empêchant la protéine d'être rendue complètement non fonctionnelle.

Le code génétique est presque universel. À quelques exceptions mineures près, pratiquement toutes les espèces utilisent le même code génétique pour la synthèse des protéines. La conservation des codons signifie qu'un ARNm purifié codant pour la protéine de globine chez les chevaux pourrait être transféré à une cellule de tulipe, et la tulipe synthétiserait la globine de cheval. Le fait qu'il n'y ait qu'un seul code génétique est une preuve puissante que toute la vie sur Terre partage une origine commune, d'autant plus qu'il existe environ 10 84 combinaisons possibles de 20 acides aminés et 64 codons triplets.

Voir Transcrire et traduire un gène (page Web, animation Flash) pour transcrire un gène et le traduire en protéine en utilisant l'appariement complémentaire et le code génétique.

Lequel a le plus d'ADN : un kiwi ou une fraise ?

Question: Est-ce qu'un kiwi et une fraise qui ont approximativement la même taille ((Figure)) auraient aussi approximativement la même quantité d'ADN ?

Fond: Les gènes sont portés par les chromosomes et sont constitués d'ADN. Tous les mammifères sont diploïdes, ce qui signifie qu'ils ont deux copies de chaque chromosome. Cependant, toutes les plantes ne sont pas diploïdes. Le fraisier commun est octoploïde (8m) et le kiwi cultivé est hexaploïde (6m). Recherchez le nombre total de chromosomes dans les cellules de chacun de ces fruits et réfléchissez à la façon dont cela pourrait correspondre à la quantité d'ADN dans les noyaux cellulaires de ces fruits. Quels autres facteurs pourraient contribuer à la quantité totale d'ADN dans un seul fruit ? Découvrez la technique d'isolement de l'ADN pour comprendre comment chaque étape du protocole d'isolement aide à libérer et à précipiter l'ADN.

Hypothèse: Faites l'hypothèse que vous seriez capable de détecter une différence dans la quantité d'ADN à partir de fraises et de kiwis de taille similaire. Selon vous, quel fruit produirait plus d'ADN ?

Testez votre hypothèse: Isolez l'ADN d'une fraise et d'un kiwi de taille similaire. Réalisez l'expérience au moins en triple pour chaque fruit

  1. Préparez une bouteille de tampon d'extraction d'ADN à partir de 900 ml d'eau, 50 ml de détergent à vaisselle et deux cuillères à café de sel de table. Mélangez par inversion (bouchez et retournez quelques fois).
  2. Broyez une fraise et un kiwi à la main dans un sac en plastique, ou à l'aide d'un mortier et d'un pilon, ou avec un bol en métal et l'extrémité d'un instrument émoussé. Broyer pendant au moins deux minutes par fruit.
  3. Ajouter 10 ml de tampon d'extraction d'ADN à chaque fruit et bien mélanger pendant au moins une minute.
  4. Retirez les débris cellulaires en filtrant chaque mélange de fruits à travers une étamine ou un tissu poreux et dans un entonnoir placé dans un tube à essai ou un récipient approprié.
  5. Versez de l'éthanol glacé ou de l'isopropanol (alcool à friction) dans le tube à essai. Vous devriez observer un ADN précipité blanc.
  6. Rassemblez l'ADN de chaque fruit en l'enroulant autour de tiges de verre séparées.

Enregistrez vos observations: Étant donné que vous ne mesurez pas quantitativement le volume d'ADN, vous pouvez enregistrer pour chaque essai si les deux fruits ont produit des quantités d'ADN identiques ou différentes, comme observé à l'œil nu. Si l'un ou l'autre fruit a produit sensiblement plus d'ADN, notez-le également. Déterminez si vos observations sont cohérentes avec plusieurs morceaux de chaque fruit.

Analysez vos données: Avez-vous remarqué une différence évidente dans la quantité d'ADN produite par chaque fruit ? Vos résultats étaient-ils reproductibles ?

Tirer une conclusion: Compte tenu de ce que vous savez du nombre de chromosomes dans chaque fruit, pouvez-vous conclure que le nombre de chromosomes est nécessairement corrélé à la quantité d'ADN ? Pouvez-vous identifier des inconvénients à cette procédure? Si vous aviez accès à un laboratoire, comment pourriez-vous standardiser votre comparaison et la rendre plus quantitative ?

Résumé de la section

Le code génétique fait référence à l'alphabet ADN (A, T, C, G), à l'alphabet ARN (A, U, C, G) et à l'alphabet polypeptidique (20 acides aminés). Le dogme central décrit le flux d'informations génétiques dans la cellule des gènes à l'ARNm aux protéines. Les gènes sont utilisés pour fabriquer de l'ARNm par le processus de transcription L'ARNm est utilisé pour synthétiser des protéines par le processus de traduction. Le code génétique est dégénéré car 64 codons triplets dans l'ARNm spécifient seulement 20 acides aminés et trois codons non-sens. La plupart des acides aminés ont plusieurs codons similaires. Presque toutes les espèces de la planète utilisent le même code génétique.

Réponse libre

Imaginez s'il y avait 200 acides aminés courants au lieu de 20. Compte tenu de ce que vous savez du code génétique, quelle serait la longueur de codon la plus courte possible ? Expliquer.

Pour 200 acides aminés courants, les codons constitués de quatre types de nucléotides devraient avoir au moins quatre nucléotides de long, car 4 4 = 256. Il y aurait beaucoup moins de dégénérescence dans ce cas.

Discutez de la façon dont la dégénérescence du code génétique rend les cellules plus résistantes aux mutations.

Les codons qui spécifient le même acide aminé ne diffèrent généralement que d'un nucléotide. De plus, les acides aminés avec des chaînes latérales chimiquement similaires sont codés par des codons similaires. Cette nuance du code génétique garantit qu'une mutation de substitution d'un seul nucléotide pourrait soit spécifier le même acide aminé et n'avoir aucun effet, soit spécifier un acide aminé similaire, empêchant la protéine d'être rendue complètement non fonctionnelle.

Un scientifique séquençant l'ARNm identifie le brin suivant : CUAUGUGUCGUAACAGCCGAUGACCCG

Quelle est la séquence de la chaîne d'acides aminés que cet ARNm fait lorsqu'il est traduit ?

La première étape de l'écriture de la séquence d'acides aminés consiste à trouver le codon de départ AUG. Ensuite, la séquence nucléotidique est séparée en triplets : CU AUG UGU CGU AAC AGC CGA UGA. Nous arrêtons la traduction à UGA car ce triplet code un codon stop. Lorsque nous convertissons ces codons en acides aminés, la séquence devient Met Cys Arg Asn Ser Arg.

Glossaire


Le code génétique

Le processus cellulaire de transcription génère un ARN messager (ARNm), une copie moléculaire mobile d'un ou plusieurs gènes avec un alphabet de A, C, G et uracile (U). La traduction de la matrice d'ARNm convertit l'information génétique basée sur les nucléotides en un produit protéique. Les séquences de protéines se composent de 20 acides aminés courants, on peut donc dire que l'alphabet des protéines se compose de 20 lettres ([link]). Chaque acide aminé est défini par une séquence de trois nucléotides appelée codon triplet. Différents acides aminés ont des chimies différentes (comme acide par rapport à basique, ou polaire et non polaire) et différentes contraintes structurelles. La variation de la séquence d'acides aminés donne lieu à d'énormes variations dans la structure et la fonction des protéines.

Le dogme central : l'ADN code l'ARN L'ARN code la protéine

Le flux d'informations génétiques dans les cellules de l'ADN à l'ARNm à la protéine est décrit par le Dogme central ([link]), qui stipule que les gènes spécifient la séquence des ARNm, qui à leur tour spécifient la séquence des protéines. Le décodage d'une molécule à une autre est effectué par des protéines et des ARN spécifiques. Parce que les informations stockées dans l'ADN sont si essentielles à la fonction cellulaire, il est logique que la cellule fasse des copies d'ARNm de ces informations pour la synthèse des protéines, tout en gardant l'ADN lui-même intact et protégé. La copie d'ADN en ARN est relativement simple, un nucléotide étant ajouté au brin d'ARNm pour chaque nucléotide lu dans le brin d'ADN. La traduction en protéine est un peu plus complexe car trois nucléotides d'ARNm correspondent à un acide aminé dans la séquence polypeptidique. Cependant, la traduction en protéine est encore systématique et colinéaire, de sorte que les nucléotides 1 à 3 correspondent à l'acide aminé 1, les nucléotides 4 à 6 correspondent à l'acide aminé 2, et ainsi de suite.

Le code génétique est dégénéré et universel

Étant donné le nombre différent de « lettres » dans les « alphabets » d'ARNm et de protéines, les scientifiques ont émis l'hypothèse que les combinaisons de nucléotides correspondaient à des acides aminés uniques. Les doublets de nucléotides ne seraient pas suffisants pour spécifier chaque acide aminé car il n'y a que 16 combinaisons possibles de deux nucléotides (4 2 ). En revanche, il existe 64 triplets de nucléotides possibles (4 3 ), ce qui est bien plus que le nombre d'acides aminés. Les scientifiques ont émis l'hypothèse que les acides aminés étaient codés par des triplets de nucléotides et que le code génétique était dégénérer. En d'autres termes, un acide aminé donné pourrait être codé par plus d'un triplet de nucléotides. Cela a ensuite été confirmé expérimentalement. Francis Crick et Sydney Brenner ont utilisé la proflavine, un mutagène chimique, pour insérer un, deux ou trois nucléotides dans le gène d'un virus. Lorsqu'un ou deux nucléotides ont été insérés, la synthèse des protéines a été complètement abolie. Lorsque trois nucléotides ont été insérés, la protéine a été synthétisée et fonctionnelle. Cela a démontré que trois nucléotides spécifient chaque acide aminé. Ces triplets de nucléotides sont appelés codons. L'insertion d'un ou deux nucléotides a complètement changé le triplet cadre de lecture, modifiant ainsi le message pour chaque acide aminé suivant ([link]). Bien que l'insertion de trois nucléotides ait entraîné l'insertion d'un acide aminé supplémentaire pendant la traduction, l'intégrité du reste de la protéine a été maintenue.

Les scientifiques ont minutieusement résolu le code génétique en traduisant des ARNm synthétiques in vitro et en séquençant les protéines qu'ils ont spécifiées ([link]).

En plus d'instruire l'ajout d'un acide aminé spécifique à une chaîne polypeptidique, trois des 64 codons terminent la synthèse des protéines et libèrent le polypeptide de la machinerie de traduction. Ces triplés sont appelés codons absurdes, ou des codons d'arrêt. Un autre codon, AUG, a également une fonction spéciale. En plus de spécifier l'acide aminé méthionine, il sert également de codon de départ pour initier la traduction. Le cadre de lecture pour la traduction est défini par le codon d'initiation AUG près de l'extrémité 5' de l'ARNm.

Le code génétique est universel. À quelques exceptions près, pratiquement toutes les espèces utilisent le même code génétique pour la synthèse des protéines. La conservation des codons signifie qu'un ARNm purifié codant pour la protéine de globine chez les chevaux pourrait être transféré à une cellule de tulipe, et la tulipe synthétiserait la globine de cheval. Le fait qu'il n'y ait qu'un seul code génétique est une preuve puissante que toute la vie sur Terre partage une origine commune, d'autant plus qu'il existe environ 10 84 combinaisons possibles de 20 acides aminés et 64 codons triplets.

Transcrivez un gène et traduisez-le en protéine en utilisant un appariement complémentaire et le code génétique sur ce site.

On pense que la dégénérescence est un mécanisme cellulaire pour réduire l'impact négatif des mutations aléatoires. Les codons qui spécifient le même acide aminé ne diffèrent généralement que d'un nucléotide. De plus, les acides aminés avec des chaînes latérales chimiquement similaires sont codés par des codons similaires. Cette nuance du code génétique garantit qu'une mutation de substitution d'un seul nucléotide pourrait soit spécifier le même acide aminé mais n'avoir aucun effet, soit spécifier un acide aminé similaire, empêchant la protéine d'être rendue complètement non fonctionnelle.

Lequel a le plus d'ADN : un kiwi ou une fraise ?

Question: Est-ce qu'un kiwi et une fraise qui ont approximativement la même taille ([link]) auraient aussi approximativement la même quantité d'ADN ?

Fond: Les gènes sont portés par les chromosomes et sont constitués d'ADN. Tous les mammifères sont diploïdes, ce qui signifie qu'ils ont deux copies de chaque chromosome. Cependant, toutes les plantes ne sont pas diploïdes. Le fraisier commun est octoploïde (8m) et le kiwi cultivé est hexaploïde (6m). Recherchez le nombre total de chromosomes dans les cellules de chacun de ces fruits et réfléchissez à la façon dont cela pourrait correspondre à la quantité d'ADN dans les noyaux cellulaires de ces fruits. Découvrez la technique d'isolement de l'ADN pour comprendre comment chaque étape du protocole d'isolement aide à libérer et à précipiter l'ADN.

Hypothèse: Faites l'hypothèse que vous seriez capable de détecter une différence dans la quantité d'ADN à partir de fraises et de kiwis de taille similaire. Selon vous, quel fruit produirait plus d'ADN ?

Testez votre hypothèse: Isolez l'ADN d'une fraise et d'un kiwi de taille similaire. Effectuez l'expérience au moins en triple pour chaque fruit.

  1. Préparez une bouteille de tampon d'extraction d'ADN à partir de 900 ml d'eau, 50 ml de détergent à vaisselle et deux cuillères à café de sel de table. Mélangez par inversion (bouchez et retournez quelques fois).
  2. Broyez une fraise et un kiwi à la main dans un sac en plastique, ou à l'aide d'un mortier et d'un pilon, ou avec un bol en métal et l'extrémité d'un instrument émoussé. Broyer pendant au moins deux minutes par fruit.
  3. Ajouter 10 ml de tampon d'extraction d'ADN à chaque fruit et bien mélanger pendant au moins une minute.
  4. Retirez les débris cellulaires en filtrant chaque mélange de fruits à travers une étamine ou un tissu poreux et dans un entonnoir placé dans un tube à essai ou un récipient approprié.
  5. Versez de l'éthanol glacé ou de l'isopropanol (alcool à friction) dans le tube à essai. Vous devriez observer un ADN précipité blanc.
  6. Rassemblez l'ADN de chaque fruit en l'enroulant autour de tiges de verre séparées.

Enregistrez vos observations: Étant donné que vous ne mesurez pas quantitativement le volume d'ADN, vous pouvez enregistrer pour chaque essai si les deux fruits ont produit des quantités d'ADN identiques ou différentes, comme observé à l'œil nu. Si l'un ou l'autre fruit a produit sensiblement plus d'ADN, notez-le également. Déterminez si vos observations sont cohérentes avec plusieurs morceaux de chaque fruit.

Analysez vos données: Avez-vous remarqué une différence évidente dans la quantité d'ADN produite par chaque fruit ? Vos résultats étaient-ils reproductibles ?

Tirer une conclusion: Compte tenu de ce que vous savez du nombre de chromosomes dans chaque fruit, pouvez-vous conclure que le nombre de chromosomes est nécessairement corrélé à la quantité d'ADN ? Pouvez-vous identifier des inconvénients à cette procédure? Si vous aviez accès à un laboratoire, comment pourriez-vous standardiser votre comparaison et la rendre plus quantitative ?

Résumé de la section

Le code génétique fait référence à l'alphabet ADN (A, T, C, G), à l'alphabet ARN (A, U, C, G) et à l'alphabet polypeptidique (20 acides aminés). Le dogme central décrit le flux d'informations génétiques dans la cellule des gènes à l'ARNm aux protéines. Les gènes sont utilisés pour fabriquer de l'ARNm par le processus de transcription L'ARNm est utilisé pour synthétiser des protéines par le processus de traduction. Le code génétique est dégénéré car 64 codons triplets dans l'ARNm spécifient seulement 20 acides aminés et trois codons non-sens. Presque toutes les espèces de la planète utilisent le même code génétique.

Questions de révision

Les codons AUC et AUA dans l'ARNm spécifient tous deux l'isoleucine. Quelle caractéristique du code génétique explique cela ?


Réponse libre

Imaginez s'il y avait 200 acides aminés courants au lieu de 20. Compte tenu de ce que vous savez du code génétique, quelle serait la longueur de codon la plus courte possible ? Expliquer.

Pour 200 acides aminés courants, les codons constitués de quatre types de nucléotides devraient avoir au moins quatre nucléotides de long, car 4 4 = 256. Il y aurait beaucoup moins de dégénérescence dans ce cas.

Discutez de la façon dont la dégénérescence du code génétique rend les cellules plus résistantes aux mutations.

Les codons qui spécifient le même acide aminé ne diffèrent généralement que d'un nucléotide. De plus, les acides aminés avec des chaînes latérales chimiquement similaires sont codés par des codons similaires. Cette nuance du code génétique garantit qu'une mutation de substitution d'un seul nucléotide pourrait soit spécifier le même acide aminé et n'avoir aucun effet, soit spécifier un acide aminé similaire, empêchant la protéine d'être rendue complètement non fonctionnelle.

Un scientifique séquençant l'ARNm identifie le brin suivant : CUAUGUGUCGUAACAGCCGAUGACCCG

Quelle est la séquence de la chaîne d'acides aminés que cet ARNm fait lorsqu'il est traduit ?

La première étape de l'écriture de la séquence d'acides aminés consiste à trouver le codon de départ AUG. Ensuite, la séquence nucléotidique est séparée en triplets : CU AUG UGU CGU AAC AGC CGA UGA. Nous arrêtons la traduction à UGA car ce triplet code un codon d'arrêt. Lorsque nous convertissons ces codons en acides aminés, la séquence devient Met Cys Arg Asn Ser Arg.


Dégénérescence du code génétique

Crick&# x02019s travail a également suggéré que le code génétique est dégénérer. Cette expression n'est pas un acte d'accusation moral. Cela signifie simplement que chacun des 64 triplets doit avoir une signification dans le code, donc au moins certains acides aminés doivent être spécifiés par deux triplets différents ou plus. Si seulement 20 triplets sont utilisés (les 44 autres étant absurdes, en ce sens qu'ils ne codent pour aucun acide aminé), alors la plupart des mutations de décalage du cadre de lecture peuvent produire des mots absurdes, ce qui arrête vraisemblablement le processus de construction des protéines. Si tel était le cas, la suppression des mutations de décalage du cadre de lecture fonctionnerait rarement, voire jamais. Cependant, si tous les triplets spécifiaient un acide aminé, les mots modifiés entraîneraient simplement l'insertion d'acides aminés incorrects dans la protéine. Ainsi, Crick a estimé que plusieurs ou tous les acides aminés doivent avoir plusieurs noms différents dans le code de la paire de bases, cette hypothèse a ensuite été confirmée biochimiquement.

UN MESSAGE

La discussion jusqu'ici montre que

Trois bases codent pour un acide aminé. Ces triplets sont appelés codons.

Le code est lu à partir d'un point de départ fixe et se poursuit jusqu'à la fin de la séquence de codage. Nous le savons parce qu'une seule mutation de décalage du cadre de lecture n'importe où dans la séquence codante modifie l'alignement des codons pour le reste de la séquence.

Le code est dégénéré en ce que certains acides aminés sont spécifiés par plus d'un codon.


Le code génétique est dégénéré et universel

Étant donné le nombre différent de « lettres » dans les « alphabets » d'ARNm et de protéines, les scientifiques ont émis l'hypothèse que les combinaisons de nucléotides correspondaient à des acides aminés uniques. Les doublets de nucléotides ne seraient pas suffisants pour spécifier chaque acide aminé car il n'y a que 16 combinaisons possibles de deux nucléotides (4 2 ). En revanche, il existe 64 triplets de nucléotides possibles (4 3 ), ce qui est bien plus que le nombre d'acides aminés. Les scientifiques ont émis l'hypothèse que les acides aminés étaient codés par des triplets de nucléotides et que le code génétique était dégénéré. En d'autres termes, un acide aminé donné pourrait être codé par plus d'un triplet de nucléotides. Cela a ensuite été confirmé expérimentalement. Francis Crick et Sydney Brenner ont utilisé la proflavine, un mutagène chimique, pour insérer un, deux ou trois nucléotides dans le gène d'un virus. Lorsqu'un ou deux nucléotides ont été insérés, la synthèse des protéines a été complètement abolie. Lorsque trois nucléotides ont été insérés, la protéine a été synthétisée et fonctionnelle. Cela a démontré que trois nucléotides spécifient chaque acide aminé. Ces triplets de nucléotides sont appelés codons. L'insertion d'un ou deux nucléotides a complètement changé le cadre de lecture du triplet, modifiant ainsi le message pour chaque acide aminé suivant ([link]). Bien que l'insertion de trois nucléotides ait entraîné l'insertion d'un acide aminé supplémentaire pendant la traduction, l'intégrité du reste de la protéine a été maintenue.

Les scientifiques ont minutieusement résolu le code génétique en traduisant des ARNm synthétiques in vitro et en séquençant les protéines qu'ils ont spécifiées ([link]).

En plus d'instruire l'ajout d'un acide aminé spécifique à une chaîne polypeptidique, trois des 64 codons terminent la synthèse des protéines et libèrent le polypeptide de la machinerie de traduction. Ces triplets sont appelés codons non-sens ou codons stop. Un autre codon, AUG, a également une fonction spéciale. En plus de spécifier l'acide aminé méthionine, il sert également de codon de départ pour initier la traduction. Le cadre de lecture pour la traduction est défini par le codon de démarrage AUG près de l'extrémité 5 & 8242 de l'ARNm.

Le code génétique est universel. À quelques exceptions près, pratiquement toutes les espèces utilisent le même code génétique pour la synthèse des protéines. La conservation des codons signifie qu'un ARNm purifié codant pour la protéine de globine chez les chevaux pourrait être transféré à une cellule de tulipe, et la tulipe synthétiserait la globine de cheval. Le fait qu'il n'y ait qu'un seul code génétique est une preuve puissante que toute la vie sur Terre partage une origine commune, d'autant plus qu'il existe environ 10 84 combinaisons possibles de 20 acides aminés et 64 codons triplets.

Transcrivez un gène et traduisez-le en protéine en utilisant un appariement complémentaire et le code génétique sur ce site.

On pense que la dégénérescence est un mécanisme cellulaire pour réduire l'impact négatif des mutations aléatoires. Les codons qui spécifient le même acide aminé ne diffèrent généralement que d'un nucléotide. De plus, les acides aminés avec des chaînes latérales chimiquement similaires sont codés par des codons similaires. Cette nuance du code génétique garantit qu'une mutation de substitution d'un seul nucléotide pourrait soit spécifier le même acide aminé mais n'avoir aucun effet, soit spécifier un acide aminé similaire, empêchant la protéine d'être rendue complètement non fonctionnelle.

Lequel a le plus d'ADN : un kiwi ou une fraise ?

Question: Est-ce qu'un kiwi et une fraise qui ont approximativement la même taille ([link]) auraient aussi approximativement la même quantité d'ADN ?

Fond: Les gènes sont portés par les chromosomes et sont constitués d'ADN. Tous les mammifères sont diploïdes, ce qui signifie qu'ils ont deux copies de chaque chromosome. Cependant, toutes les plantes ne sont pas diploïdes. Le fraisier commun est octoploïde (8m) et le kiwi cultivé est hexaploïde (6m). Recherchez le nombre total de chromosomes dans les cellules de chacun de ces fruits et réfléchissez à la façon dont cela pourrait correspondre à la quantité d'ADN dans les noyaux cellulaires de ces fruits. Découvrez la technique d'isolement de l'ADN pour comprendre comment chaque étape du protocole d'isolement aide à libérer et à précipiter l'ADN.

Hypothèse: Faites l'hypothèse que vous seriez capable de détecter une différence dans la quantité d'ADN à partir de fraises et de kiwis de taille similaire. Selon vous, quel fruit produirait plus d'ADN ?

Testez votre hypothèse: Isolez l'ADN d'une fraise et d'un kiwi de taille similaire. Effectuez l'expérience au moins en triple pour chaque fruit.

  1. Préparez une bouteille de tampon d'extraction d'ADN à partir de 900 ml d'eau, 50 ml de détergent à vaisselle et deux cuillères à café de sel de table. Mélangez par inversion (bouchez et retournez quelques fois).
  2. Broyez une fraise et un kiwi à la main dans un sac en plastique, ou à l'aide d'un mortier et d'un pilon, ou avec un bol en métal et l'extrémité d'un instrument émoussé. Broyer pendant au moins deux minutes par fruit.
  3. Ajouter 10 ml de tampon d'extraction d'ADN à chaque fruit et bien mélanger pendant au moins une minute.
  4. Retirez les débris cellulaires en filtrant chaque mélange de fruits à travers une étamine ou un tissu poreux et dans un entonnoir placé dans un tube à essai ou un récipient approprié.
  5. Versez de l'éthanol glacé ou de l'isopropanol (alcool à friction) dans le tube à essai. Vous devriez observer un ADN précipité blanc.
  6. Rassemblez l'ADN de chaque fruit en l'enroulant autour de tiges de verre séparées.

Enregistrez vos observations: Étant donné que vous ne mesurez pas quantitativement le volume d'ADN, vous pouvez enregistrer pour chaque essai si les deux fruits ont produit des quantités d'ADN identiques ou différentes, comme observé à l'œil nu. Si l'un ou l'autre fruit a produit sensiblement plus d'ADN, notez-le également. Déterminez si vos observations sont cohérentes avec plusieurs morceaux de chaque fruit.

Analysez vos données: Avez-vous remarqué une différence évidente dans la quantité d'ADN produite par chaque fruit ? Vos résultats étaient-ils reproductibles ?

Tirer une conclusion: Compte tenu de ce que vous savez du nombre de chromosomes dans chaque fruit, pouvez-vous conclure que le nombre de chromosomes est nécessairement corrélé à la quantité d'ADN ? Pouvez-vous identifier des inconvénients à cette procédure? Si vous aviez accès à un laboratoire, comment pourriez-vous standardiser votre comparaison et la rendre plus quantitative ?


Caractéristiques du code génétique

Triplet nature

Un code triplet pourrait créer un code génétique pour 64 combinaisons différentes (4 X 4 X 4) de code génétique et fournir de nombreuses informations dans la molécule d'ADN pour spécifier le placement des 20 acides aminés. Lorsque des expériences ont été effectuées pour déchiffrer le code génétique, il s'est avéré qu'il s'agissait d'un code en triplet. Ces codes à trois lettres de nucléotides (AUG, AAA, etc.) sont appelés codons.

Dégénérescence

Le code est dégénéré, ce qui signifie que le même acide aminé est codé par plus d'un triplet de bases. Par exemple, les trois acides aminés arginine, alanine et leucine ont chacun six codons synonymes.

Non chevauchement

Le code génétique ne se chevauche pas, c'est-à-dire que les codons adjacents ne se chevauchent pas. Un code sans chevauchement signifie que la même lettre n'est pas utilisée pour deux codons différents. En d'autres termes, aucune base ne peut participer à la formation de plus d'un codon.

Sans virgule

Il n'y a pas de signal pour indiquer la fin d'un codon et le début du suivant. Le code génétique est sans virgule (ou sans virgule).

Non-ambiguïté

Un codon particulier codera toujours pour le même acide aminé. Alors qu'un même acide aminé peut être codé par plus d'un codon (le code est dégénéré), le même codon ne doit pas coder pour deux ou plusieurs acides aminés différents (non ambigu).

Universalité

Bien que le code soit basé sur des travaux menés sur la bactérie Escherichia coli, il est valable pour d'autres organismes. Cette caractéristique importante du code génétique est appelée son universalité. Cela signifie que les mêmes séquences de 3 bases codent pour les mêmes acides aminés dans toutes les formes de vie, des simples micro-organismes aux organismes multicellulaires complexes tels que les êtres humains.

Polarité

Le code génétique a une polarité, c'est-à-dire que le code est toujours lu dans un sens fixe, c'est-à-dire dans le sens 5′ → 3′.

Codons d'initiation de la chaîne

Les triplés AUG et GUG jouent un double rôle dans E. coli. Lorsqu'elles se situent entre les deux extrémités d'un cistron (position intermédiaire), elles codent pour les acides aminés méthionine et valine, respectivement en position intermédiaire dans la molécule de protéine.

Codons de terminaison de chaîne

Les 3 triplets UAA, UAG, UGA ne codent pour aucun acide aminé. Ils étaient à l'origine décrits comme des codons non-sens, par rapport aux 61 autres codons, appelés codons sens.


Résumé de la section

Le code génétique fait référence à l'alphabet ADN (A, T, C, G), à l'alphabet ARN (A, U, C, G) et à l'alphabet polypeptidique (20 acides aminés). Le dogme central décrit le flux d'informations génétiques dans la cellule des gènes à l'ARNm aux protéines. Les gènes sont utilisés pour fabriquer de l'ARNm par le processus de transcription L'ARNm est utilisé pour synthétiser des protéines par le processus de traduction. Le code génétique est dégénéré car 64 codons triplets dans l'ARNm spécifient seulement 20 acides aminés et trois codons non-sens. La plupart des acides aminés ont plusieurs codons similaires. Presque toutes les espèces de la planète utilisent le même code génétique.


Voir la vidéo: From DNA to protein - 3D (Mai 2022).